Transcript: Human XM_017007452.1

PREDICTED: Homo sapiens BOC cell adhesion associated, oncogene regulated (BOC), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BOC (91653)
Length:
3829
CDS:
181..3228

Additional Resources:

NCBI RefSeq record:
XM_017007452.1
NBCI Gene record:
BOC (91653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073372 GAGGGAAACACAGCAGTCATT pLKO.1 295 CDS 100% 4.950 6.930 N BOC n/a
2 TRCN0000073369 CCCGTATACTATGGTGCCATT pLKO.1 2586 CDS 100% 4.050 5.670 N BOC n/a
3 TRCN0000232653 ATATCCCAGAAAGACTATATA pLKO_005 3239 3UTR 100% 15.000 10.500 N BOC n/a
4 TRCN0000232652 ACACCACCTCTCACAATTTAG pLKO_005 3208 CDS 100% 13.200 9.240 N BOC n/a
5 TRCN0000232650 ACCTCCAAGACAGACTCATAT pLKO_005 1327 CDS 100% 13.200 9.240 N BOC n/a
6 TRCN0000232651 GAGACCTCCTACGACATTAAG pLKO_005 2230 CDS 100% 13.200 9.240 N BOC n/a
7 TRCN0000232649 TAGATGTGCAGCACGTGATTG pLKO_005 266 CDS 100% 10.800 7.560 N BOC n/a
8 TRCN0000073371 CCTCTACAATGTCCAGGTGTT pLKO.1 810 CDS 100% 4.050 2.835 N BOC n/a
9 TRCN0000073370 CGACATTAAGATGCAGTGCTT pLKO.1 2241 CDS 100% 2.640 1.848 N BOC n/a
10 TRCN0000073368 CCCATGAGAACAGACCAAGAT pLKO.1 3684 3UTR 100% 4.950 2.970 N BOC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.