Transcript: Human XM_017007940.1

PREDICTED: Homo sapiens adhesion G protein-coupled receptor L3 (ADGRL3), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRL3 (23284)
Length:
12380
CDS:
288..4214

Additional Resources:

NCBI RefSeq record:
XM_017007940.1
NBCI Gene record:
ADGRL3 (23284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273812 GACTGTTCTGAGTTGATATAA pLKO_005 5000 3UTR 100% 15.000 21.000 N ADGRL3 n/a
2 TRCN0000285068 AGCGTACAATGACAGGTTATT pLKO_005 2965 CDS 100% 13.200 18.480 N ADGRL3 n/a
3 TRCN0000273868 CCGTGTCCAGGAACCTATAAA pLKO_005 816 CDS 100% 15.000 10.500 N ADGRL3 n/a
4 TRCN0000011692 CCAGAATTTGAGTCCTGTTAA pLKO.1 5654 3UTR 100% 13.200 9.240 N ADGRL3 n/a
5 TRCN0000174411 CCTGTGGTATTTACTGTTAAA pLKO.1 2886 CDS 100% 13.200 9.240 N Adgrl3 n/a
6 TRCN0000011695 CCCGAGAAATCATGTGGTTTA pLKO.1 1999 CDS 100% 10.800 7.560 N ADGRL3 n/a
7 TRCN0000011696 CCTAATTCATACCAGTACATT pLKO.1 1563 CDS 100% 5.625 3.938 N ADGRL3 n/a
8 TRCN0000273869 CCTAATTCATACCAGTACATT pLKO_005 1563 CDS 100% 5.625 3.938 N ADGRL3 n/a
9 TRCN0000011693 CCCTGTTATTACGGCAGCAAT pLKO.1 2828 CDS 100% 4.950 2.970 N ADGRL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.