Transcript: Human XM_017007990.2

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor gamma1 subunit (GABRG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRG1 (2565)
Length:
6441
CDS:
212..1222

Additional Resources:

NCBI RefSeq record:
XM_017007990.2
NBCI Gene record:
GABRG1 (2565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222089 CCCTGTTCAACTTGGTTTATT pLKO.1 1179 CDS 100% 15.000 21.000 N GABRG1 n/a
2 TRCN0000222090 CCTGGTTTGACAGTCGTTTAA pLKO.1 177 5UTR 100% 13.200 18.480 N GABRG1 n/a
3 TRCN0000435248 GCTTATGCTTAACAGTAATAT pLKO_005 220 CDS 100% 15.000 12.000 N GABRG1 n/a
4 TRCN0000430962 TAATCGTCTGCTTCGAATTTG pLKO_005 316 CDS 100% 13.200 9.240 N GABRG1 n/a
5 TRCN0000222091 CCATGCATTCTGACAGTTGTT pLKO.1 662 CDS 100% 4.950 3.465 N GABRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06245 pDONR223 100% 72.1% 71.8% None 0_1ins387;821G>A;1004A>C n/a
2 ccsbBroad304_06245 pLX_304 0% 72.1% 71.8% V5 0_1ins387;821G>A;1004A>C n/a
Download CSV