Transcript: Human XM_017008295.2

PREDICTED: Homo sapiens nucleoporin 54 (NUP54), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP54 (53371)
Length:
4627
CDS:
2942..3925

Additional Resources:

NCBI RefSeq record:
XM_017008295.2
NBCI Gene record:
NUP54 (53371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293960 TAGTTGCATGCCCAGTAATAA pLKO_005 2935 5UTR 100% 15.000 21.000 N NUP54 n/a
2 TRCN0000059906 CGCCAAATGGTACTTCAAGAA pLKO.1 3144 CDS 100% 4.950 6.930 N NUP54 n/a
3 TRCN0000286569 CGCCAAATGGTACTTCAAGAA pLKO_005 3144 CDS 100% 4.950 6.930 N NUP54 n/a
4 TRCN0000059907 GCATCAAACCAGATTAGATAT pLKO.1 3439 CDS 100% 13.200 10.560 N NUP54 n/a
5 TRCN0000293959 CTGCTTTCCATACCAAGTAAA pLKO_005 4264 3UTR 100% 13.200 9.240 N NUP54 n/a
6 TRCN0000059903 CCAAGGTAGATAACCCTGATT pLKO.1 3336 CDS 100% 4.950 3.465 N NUP54 n/a
7 TRCN0000286570 CCAAGGTAGATAACCCTGATT pLKO_005 3336 CDS 100% 4.950 3.465 N NUP54 n/a
8 TRCN0000059905 GCCATTTGATTAGCATCATTA pLKO.1 3825 CDS 100% 13.200 7.920 N NUP54 n/a
9 TRCN0000286503 GCCATTTGATTAGCATCATTA pLKO_005 3825 CDS 100% 13.200 7.920 N NUP54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12022 pDONR223 100% 61.7% 61.7% None 0_1ins540;940_981del n/a
2 ccsbBroad304_12022 pLX_304 0% 61.7% 61.7% V5 0_1ins540;940_981del n/a
Download CSV