Transcript: Human XM_017008335.1

PREDICTED: Homo sapiens membrane associated ring-CH-type finger 1 (MARCHF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCHF1 (55016)
Length:
5388
CDS:
501..1358

Additional Resources:

NCBI RefSeq record:
XM_017008335.1
NBCI Gene record:
MARCHF1 (55016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412769 ACTTGAATTGCGATGTGTATT pLKO_005 1717 3UTR 100% 13.200 18.480 N MARCHF1 n/a
2 TRCN0000433490 GCGTAAAGTAAAGTATGATAT pLKO_005 1553 3UTR 100% 13.200 18.480 N MARCHF1 n/a
3 TRCN0000430137 GGCAGTAATCAAAGATTAAAT pLKO_005 1644 3UTR 100% 15.000 10.500 N MARCHF1 n/a
4 TRCN0000423956 TAATGGAGACCAAGCTCAAAC pLKO_005 880 CDS 100% 10.800 7.560 N MARCHF1 n/a
5 TRCN0000037019 GCTCTGTCACATTCCACGTAA pLKO.1 958 CDS 100% 4.950 3.465 N MARCHF1 n/a
6 TRCN0000037020 GAGAAGAACTTCTCATGTAAT pLKO.1 1233 CDS 100% 1.320 0.924 N MARCHF1 n/a
7 TRCN0000037021 GTACAGTGTAAAGTCTATGTT pLKO.1 1137 CDS 100% 5.625 3.375 N MARCHF1 n/a
8 TRCN0000176143 GCAAGTCGATCAAGTAACATA pLKO.1 624 CDS 100% 5.625 7.875 N March1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008335.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.