Transcript: Human XM_017008389.1

PREDICTED: Homo sapiens teneurin transmembrane protein 3 (TENM3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENM3 (55714)
Length:
11373
CDS:
560..8704

Additional Resources:

NCBI RefSeq record:
XM_017008389.1
NBCI Gene record:
TENM3 (55714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245947 CTATGACGACCACCGTAAATT pLKO_005 5968 CDS 100% 15.000 21.000 N TENM3 n/a
2 TRCN0000245948 CCGTATCAAGGAGATTCAATA pLKO_005 6859 CDS 100% 13.200 18.480 N TENM3 n/a
3 TRCN0000245946 TGATCGGCTTTAACGAATATG pLKO_005 8880 3UTR 100% 13.200 18.480 N TENM3 n/a
4 TRCN0000112357 GCAGTAATGTACCACTGGAAA pLKO.1 1284 CDS 100% 4.950 6.930 N Tenm3 n/a
5 TRCN0000245950 ACCATGACCCAGTCTATTATT pLKO_005 3647 CDS 100% 15.000 10.500 N TENM3 n/a
6 TRCN0000245949 CAGACTGCTCAAACGAAATAT pLKO_005 2580 CDS 100% 15.000 10.500 N TENM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.