Transcript: Human XM_017008586.1

PREDICTED: Homo sapiens wolframin ER transmembrane glycoprotein (WFS1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WFS1 (7466)
Length:
3619
CDS:
141..2822

Additional Resources:

NCBI RefSeq record:
XM_017008586.1
NBCI Gene record:
WFS1 (7466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063845 CGACACGGATGAAGAACTCAA pLKO.1 494 CDS 100% 4.950 6.930 N WFS1 n/a
2 TRCN0000063844 CGACCGCTACAAGTTTGAGAT pLKO.1 2459 CDS 100% 4.950 6.930 N WFS1 n/a
3 TRCN0000255641 TTCCTGCAGGACGACGAAGAT pLKO_005 939 CDS 100% 4.950 6.930 N WFS1 n/a
4 TRCN0000255636 TTGAATTGGCCCTACCTGAAG pLKO_005 1575 CDS 100% 4.050 5.670 N WFS1 n/a
5 TRCN0000063846 GATCACTAAGAAGTACGCCAA pLKO.1 896 CDS 100% 2.160 3.024 N WFS1 n/a
6 TRCN0000364298 GTCATGTACTGGAAGCTCAAC pLKO_005 693 CDS 100% 4.050 3.240 N WFS1 n/a
7 TRCN0000255639 ATGGCACAGCTGAGGAATTTC pLKO_005 1701 CDS 100% 13.200 9.240 N WFS1 n/a
8 TRCN0000255634 ACAAAGGGAGACATGGAAATC pLKO_005 387 CDS 100% 10.800 7.560 N WFS1 n/a
9 TRCN0000255635 ACATCGCGCTGGATGACTTTG pLKO_005 871 CDS 100% 10.800 7.560 N WFS1 n/a
10 TRCN0000255633 TCTATGTCTACCTGCTCTATC pLKO_005 1669 CDS 100% 10.800 7.560 N WFS1 n/a
11 TRCN0000364365 TGCTGTTCTGCTGGTTCTATG pLKO_005 2080 CDS 100% 10.800 7.560 N WFS1 n/a
12 TRCN0000364364 GCTGTCATCACCGGCTTCTTT pLKO_005 1446 CDS 100% 5.625 3.938 N WFS1 n/a
13 TRCN0000255638 AGCACCCTGTTCCCTCTTTCT pLKO_005 3164 3UTR 100% 4.950 3.465 N WFS1 n/a
14 TRCN0000255642 ATCAAGGAGTACCTGATTGAC pLKO_005 1044 CDS 100% 4.950 3.465 N WFS1 n/a
15 TRCN0000255640 CCACATCAACGCGCTCATCTT pLKO_005 1115 CDS 100% 4.950 3.465 N WFS1 n/a
16 TRCN0000364299 CCTACCTGGTGTGCTTCATGT pLKO_005 1747 CDS 100% 4.950 3.465 N WFS1 n/a
17 TRCN0000063847 CGACTTCTTCGCCTTCTTCAT pLKO.1 1163 CDS 100% 4.950 3.465 N WFS1 n/a
18 TRCN0000364297 TCTTCTACCTGTCCTTCATCT pLKO_005 1195 CDS 100% 4.950 3.465 N WFS1 n/a
19 TRCN0000364362 GATCTGCACCCTCAAGGTGTT pLKO_005 1223 CDS 100% 4.050 2.835 N WFS1 n/a
20 TRCN0000063843 GCTCTCTGTCTTCTTCGTCAT pLKO.1 1376 CDS 100% 4.050 2.835 N WFS1 n/a
21 TRCN0000364363 GTCTGAAGGTGGTCAAGTACC pLKO_005 1003 CDS 100% 4.050 2.835 N WFS1 n/a
22 TRCN0000376390 CCTGGAGCCCTATGCCCATTT pLKO_005 1352 CDS 100% 3.600 2.520 N WFS1 n/a
23 TRCN0000376389 AGCTCACCAAGATCGCAGTCA pLKO_005 1927 CDS 100% 2.640 1.848 N WFS1 n/a
24 TRCN0000255637 AGCACTTTACAGATGAGATTC pLKO_005 3123 3UTR 100% 10.800 6.480 N WFS1 n/a
25 TRCN0000364366 CAGAGGGCATGAAGGTCTACA pLKO_005 2110 CDS 100% 4.950 2.970 N WFS1 n/a
26 TRCN0000248036 ACGCCATCATGGAGATCAAAG pLKO_005 1030 CDS 100% 10.800 15.120 N Wfs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.