Transcript: Human XM_017008769.2

PREDICTED: Homo sapiens sorbin and SH3 domain containing 2 (SORBS2), transcript variant X39, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SORBS2 (8470)
Length:
4744
CDS:
733..2640

Additional Resources:

NCBI RefSeq record:
XM_017008769.2
NBCI Gene record:
SORBS2 (8470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431445 TCGACCAAACCTACAAGATAA pLKO_005 882 CDS 100% 13.200 18.480 N SORBS2 n/a
2 TRCN0000004072 CGTCCTGTGTTTACTCATGAA pLKO.1 2428 CDS 100% 4.950 3.960 N SORBS2 n/a
3 TRCN0000426720 ATCTAAGGAGTTGTCATTTAA pLKO_005 1971 CDS 100% 15.000 10.500 N SORBS2 n/a
4 TRCN0000421589 GAGAAAGGGAGATAGAGTTAT pLKO_005 2214 CDS 100% 13.200 9.240 N SORBS2 n/a
5 TRCN0000004074 CCTCGATTCCACAGACACATA pLKO.1 1053 CDS 100% 4.950 3.465 N SORBS2 n/a
6 TRCN0000004073 CGGAGAAATCGGAGAAGCTAT pLKO.1 2148 CDS 100% 4.950 3.465 N SORBS2 n/a
7 TRCN0000004071 CCTCCTTGTATCAGTCCTCTA pLKO.1 1604 CDS 100% 4.050 2.835 N SORBS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.