Transcript: Human XM_017008797.1

PREDICTED: Homo sapiens inositol polyphosphate-4-phosphatase type II B (INPP4B), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INPP4B (8821)
Length:
3703
CDS:
19..2544

Additional Resources:

NCBI RefSeq record:
XM_017008797.1
NBCI Gene record:
INPP4B (8821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382146 ATCAACTACAACCTCTTATAG pLKO_005 980 CDS 100% 13.200 18.480 N INPP4B n/a
2 TRCN0000379677 GCCGCAAACTGAATGGTATTC pLKO_005 2219 CDS 100% 10.800 15.120 N INPP4B n/a
3 TRCN0000230839 CCGTTGGCATTTCCGATTTAA pLKO_005 1775 CDS 100% 15.000 12.000 N INPP4B n/a
4 TRCN0000230838 ATACCGGATACCAGTTTATTT pLKO_005 908 CDS 100% 15.000 10.500 N INPP4B n/a
5 TRCN0000218447 ATGATGTGTTGCCAGTTATAA pLKO_005 1832 CDS 100% 15.000 10.500 N INPP4B n/a
6 TRCN0000381328 AGAGCCTGAACTGCATTATTG pLKO_005 1316 CDS 100% 13.200 9.240 N INPP4B n/a
7 TRCN0000052721 CCCTTCACATTAAAGAAGATT pLKO.1 509 CDS 100% 5.625 3.938 N INPP4B n/a
8 TRCN0000052722 CCTCCTGATTATATTTCACAT pLKO.1 2092 CDS 100% 4.950 3.465 N INPP4B n/a
9 TRCN0000052718 GCCAGAATGTTTGAGTCACTA pLKO.1 1894 CDS 100% 4.950 3.465 N INPP4B n/a
10 TRCN0000080647 CCTAAGGAATTGATTTCCCTT pLKO.1 493 CDS 100% 2.640 1.584 N Inpp4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.