Transcript: Human XM_017009138.2

PREDICTED: Homo sapiens ring finger protein 145 (RNF145), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF145 (153830)
Length:
3813
CDS:
561..2552

Additional Resources:

NCBI RefSeq record:
XM_017009138.2
NBCI Gene record:
RNF145 (153830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034121 GCAGGGTTATCGAGCTTTCAT pLKO.1 1457 CDS 100% 5.625 7.875 N RNF145 n/a
2 TRCN0000034120 CCTCTCTCTATGAATCGGTTT pLKO.1 909 CDS 100% 4.050 5.670 N RNF145 n/a
3 TRCN0000430163 CATTGCCAGACGACCAGATAA pLKO_005 2456 CDS 100% 13.200 10.560 N RNF145 n/a
4 TRCN0000429162 AGAAGTAGCCTTAGTAATAAC pLKO_005 678 CDS 100% 13.200 9.240 N RNF145 n/a
5 TRCN0000436176 ATGCATTATGTAGGTTATATC pLKO_005 732 CDS 100% 13.200 9.240 N RNF145 n/a
6 TRCN0000423175 CTGACATTCCAAGGATCTAAT pLKO_005 2660 3UTR 100% 13.200 9.240 N RNF145 n/a
7 TRCN0000034119 AGGTGATTATTGAGTCTTGTA pLKO.1 3055 3UTR 100% 4.950 3.465 N RNF145 n/a
8 TRCN0000034122 CTTTGGAGAATGGACAGTGAT pLKO.1 1994 CDS 100% 4.950 3.465 N RNF145 n/a
9 TRCN0000034123 GCAGCACTCCTTACTCTCTTT pLKO.1 1372 CDS 100% 4.950 3.465 N RNF145 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09703 pDONR223 100% 99.8% 99.5% None 26C>T;1148T>C;1970C>T n/a
2 ccsbBroad304_09703 pLX_304 0% 99.8% 99.5% V5 26C>T;1148T>C;1970C>T n/a
Download CSV