Transcript: Human XM_017009246.1

PREDICTED: Homo sapiens PDZ domain containing 2 (PDZD2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDZD2 (23037)
Length:
12107
CDS:
1682..9310

Additional Resources:

NCBI RefSeq record:
XM_017009246.1
NBCI Gene record:
PDZD2 (23037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164240 CGTCATCTCGATCATTGGGTT pLKO.1 2434 CDS 100% 2.640 3.696 N PDZD2 n/a
2 TRCN0000164376 CGGCTGAACAAGCTGGAATAA pLKO.1 9150 CDS 100% 13.200 10.560 N PDZD2 n/a
3 TRCN0000160374 CCCTGAATCAATACGAAACAA pLKO.1 5916 CDS 100% 5.625 3.938 N PDZD2 n/a
4 TRCN0000161065 GCAGGAAATGTCACGATCATT pLKO.1 7153 CDS 100% 5.625 3.938 N PDZD2 n/a
5 TRCN0000161781 CGGCTTTATCTACCTGATCAT pLKO.1 1272 5UTR 100% 4.950 3.465 N PDZD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.