Transcript: Human XM_017009438.2

PREDICTED: Homo sapiens phosphatidylinositol specific phospholipase C X domain containing 3 (PLCXD3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCXD3 (345557)
Length:
1953
CDS:
347..1096

Additional Resources:

NCBI RefSeq record:
XM_017009438.2
NBCI Gene record:
PLCXD3 (345557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078178 CCCTGCAAGTACCCAGTAAAT pLKO.1 1866 3UTR 100% 13.200 9.240 N PLCXD3 n/a
2 TRCN0000078182 GCCAGAAACTGTCCAGAATTT pLKO.1 292 5UTR 100% 13.200 9.240 N PLCXD3 n/a
3 TRCN0000078181 GCTGAAAGACATCTATGGAAA pLKO.1 613 CDS 100% 4.950 3.465 N PLCXD3 n/a
4 TRCN0000078179 CCCGAGAAACTGATCCAGTTT pLKO.1 794 CDS 100% 0.495 0.347 N PLCXD3 n/a
5 TRCN0000078180 GCATTCCTCACAGATCACCAT pLKO.1 518 CDS 100% 2.640 1.584 N PLCXD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.