Transcript: Human XM_017009453.1

PREDICTED: Homo sapiens microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAST4 (375449)
Length:
20039
CDS:
10668..17495

Additional Resources:

NCBI RefSeq record:
XM_017009453.1
NBCI Gene record:
MAST4 (375449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144934 AAACAGCTATAAGAGCCGGA pXPR_003 TGG 2692 39% 24 0.893 MAST4 MAST4 76882
2 BRDN0001147020 AGTTGGCTAATGATGTACCT pXPR_003 GGG 504 7% 9 0.6988 MAST4 MAST4 76884
3 BRDN0001144819 ACCCAGTCCGACCCACGGGT pXPR_003 GGG 4134 61% 26 0.353 MAST4 MAST4 76885
4 BRDN0001146863 CCATCGTCAGACACATCGTG pXPR_003 AGG 3237 47% 26 -0.0347 MAST4 MAST4 76883
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021452 CCAGACGAGTTACACTTCTTA pLKO.1 10587 5UTR 100% 5.625 7.875 N MAST4 n/a
2 TRCN0000021453 CCGAGTATAAGCTGGAAGGTA pLKO.1 14980 CDS 100% 3.000 2.400 N MAST4 n/a
3 TRCN0000021450 CCTTGGAAGAAATGGCTCATT pLKO.1 11206 CDS 100% 4.950 3.465 N MAST4 n/a
4 TRCN0000021449 GCCCAGGATCTGATTACCTTA pLKO.1 12060 CDS 100% 4.950 3.465 N MAST4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.