Transcript: Human XM_017009454.1

PREDICTED: Homo sapiens SUMO interacting motifs containing 1 (SIMC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIMC1 (375484)
Length:
3180
CDS:
16..2634

Additional Resources:

NCBI RefSeq record:
XM_017009454.1
NBCI Gene record:
SIMC1 (375484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128452 GCCCTCTACTTTCTGAATAAT pLKO.1 2242 CDS 100% 15.000 21.000 N SIMC1 n/a
2 TRCN0000417330 TCGACCGAAAGGACTTAATAA pLKO_005 2393 CDS 100% 15.000 21.000 N SIMC1 n/a
3 TRCN0000415364 GTGGCTGGTCAAAGCAGTAAC pLKO_005 1860 CDS 100% 10.800 15.120 N SIMC1 n/a
4 TRCN0000148471 CCACAATGTCAGGGATGTTAT pLKO.1 1836 CDS 100% 13.200 9.240 N SIMC1 n/a
5 TRCN0000417664 GCTCAAGTGTCAGTCAGATAA pLKO_005 2274 CDS 100% 13.200 9.240 N SIMC1 n/a
6 TRCN0000422185 AGACCCTAGAAGATGACTTTC pLKO_005 1739 CDS 100% 10.800 7.560 N SIMC1 n/a
7 TRCN0000425339 CAGGAACAGGAATCTTGAAAG pLKO_005 1925 CDS 100% 10.800 7.560 N SIMC1 n/a
8 TRCN0000422025 TAGACGTAGAGAAGCAGATTG pLKO_005 2462 CDS 100% 10.800 7.560 N SIMC1 n/a
9 TRCN0000435913 TGGCAGACTTGGGACGAATTG pLKO_005 2302 CDS 100% 10.800 7.560 N SIMC1 n/a
10 TRCN0000432219 CCGAGATGATGTTTGGGTTTG pLKO_005 2081 CDS 100% 6.000 4.200 N SIMC1 n/a
11 TRCN0000146627 CCTGTTCTCAAATATGGCTTA pLKO.1 2812 3UTR 100% 4.050 2.835 N SIMC1 n/a
12 TRCN0000149214 GCACGGAGAATCATTAACAGT pLKO.1 319 CDS 100% 3.000 1.800 N SIMC1 n/a
13 TRCN0000149462 GCCTGTTCTCAAATATGGCTT pLKO.1 2811 3UTR 100% 2.640 1.584 N SIMC1 n/a
14 TRCN0000128288 GCCACTCTTGACTTAACTTTA pLKO.1 190 CDS 100% 13.200 6.600 Y SIMC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14485 pDONR223 100% 37.5% 37% None (many diffs) n/a
Download CSV