Transcript: Human XM_017009725.2

PREDICTED: Homo sapiens cyclin I family member 2 (CCNI2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNI2 (645121)
Length:
2128
CDS:
52..933

Additional Resources:

NCBI RefSeq record:
XM_017009725.2
NBCI Gene record:
CCNI2 (645121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265775 TACCTGCATTGCGCCACAATT pLKO_005 625 CDS 100% 0.000 0.000 N CCNI2 n/a
2 TRCN0000256352 GTGCTAATGAATGGGTATTAT pLKO_005 1631 3UTR 100% 15.000 10.500 N CCNI2 n/a
3 TRCN0000256349 CTGCTGCAAGGAACTTGTAAT pLKO_005 849 CDS 100% 13.200 9.240 N CCNI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05719 pDONR223 100% 78.9% 78.9% None 427_429delCAG;777_778ins231 n/a
2 ccsbBroad304_05719 pLX_304 0% 78.9% 78.9% V5 427_429delCAG;777_778ins231 n/a
3 TRCN0000478500 CTCCGAGTAGCACGTCAACTTAGG pLX_317 27% 78.9% 78.9% V5 427_429delCAG;777_778ins231 n/a
Download CSV