Transcript: Human XM_017010330.1

PREDICTED: Homo sapiens E2F transcription factor 3 (E2F3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
E2F3 (1871)
Length:
5288
CDS:
865..2004

Additional Resources:

NCBI RefSeq record:
XM_017010330.1
NBCI Gene record:
E2F3 (1871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433255 GTCTTTGAGGTCTGCTAATAT pLKO_005 2444 3UTR 100% 15.000 21.000 N E2F3 n/a
2 TRCN0000413931 GACTTCATGTGTAGTTGATTA pLKO_005 1987 CDS 100% 13.200 18.480 N E2F3 n/a
3 TRCN0000238766 GAGAATCAAAGGTTAGCTTAT pLKO_005 1480 CDS 100% 10.800 15.120 N E2f3 n/a
4 TRCN0000429171 ACGAAGTCCAGATAGTCCAAA pLKO_005 1089 CDS 100% 4.950 6.930 N E2F3 n/a
5 TRCN0000412779 ACGCGGTATGATACGTCTCTT pLKO_005 1135 CDS 100% 4.950 6.930 N E2F3 n/a
6 TRCN0000013807 CCAACTCAGGACATAGCGATT pLKO.1 1754 CDS 100% 4.050 5.670 N E2F3 n/a
7 TRCN0000013806 CCTGACTCAATAGAGAGCCTA pLKO.1 1591 CDS 100% 2.640 2.112 N E2F3 n/a
8 TRCN0000238765 CTCAATAGAGAGCCTACAAAT pLKO_005 1596 CDS 100% 13.200 9.240 N E2f3 n/a
9 TRCN0000238764 CAAGGGCCCATTGAGGTTTAC pLKO_005 1633 CDS 100% 10.800 7.560 N E2f3 n/a
10 TRCN0000432734 CCAACCTAGAAGGACCGTTTG pLKO_005 1853 CDS 100% 6.000 4.200 N E2F3 n/a
11 TRCN0000013805 CCAAACTGTTATAGTTGTGAA pLKO.1 1542 CDS 100% 4.950 3.465 N E2F3 n/a
12 TRCN0000013803 CCCGCTTTACTCTTCAGGAAT pLKO.1 3420 3UTR 100% 4.950 3.465 N E2F3 n/a
13 TRCN0000013804 CCTCATTAAGAAGAAGTCTAA pLKO.1 1293 CDS 100% 4.950 3.465 N E2F3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.