Transcript: Human XM_017010605.1

PREDICTED: Homo sapiens SAM and SH3 domain containing 1 (SASH1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SASH1 (23328)
Length:
7367
CDS:
16..3876

Additional Resources:

NCBI RefSeq record:
XM_017010605.1
NBCI Gene record:
SASH1 (23328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121383 CGGCACGTTCAAGTTCATCTA pLKO.1 1938 CDS 100% 4.950 6.930 N Sash1 n/a
2 TRCN0000336278 CGGCACGTTCAAGTTCATCTA pLKO_005 1938 CDS 100% 4.950 6.930 N Sash1 n/a
3 TRCN0000165625 GCTGTCGACAATGCATTGCTA pLKO.1 2791 CDS 100% 3.000 4.200 N SASH1 n/a
4 TRCN0000159781 GCAGTAATAATTCTGACCCAA pLKO.1 1394 CDS 100% 2.640 3.696 N SASH1 n/a
5 TRCN0000158935 GAAGACTTGGATGAGTTAAAT pLKO.1 2143 CDS 100% 15.000 10.500 N SASH1 n/a
6 TRCN0000164684 CCACCCTTTCACTGTGCATAT pLKO.1 3909 3UTR 100% 10.800 7.560 N SASH1 n/a
7 TRCN0000166643 CCCTCAGATTGTACCTGAAGT pLKO.1 2715 CDS 100% 4.950 3.465 N SASH1 n/a
8 TRCN0000162559 CTGTAGAAAGTCTTCGCAGTT pLKO.1 1652 CDS 100% 4.050 2.835 N SASH1 n/a
9 TRCN0000159290 GCTGTAATATACCAGTACCAA pLKO.1 7158 3UTR 100% 3.000 2.100 N SASH1 n/a
10 TRCN0000160164 CAGAGTCAGAAAGAAACTAAT pLKO.1 450 CDS 100% 13.200 7.920 N SASH1 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5312 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5390 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 5220 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5390 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.