Transcript: Human XM_017010821.1

PREDICTED: Homo sapiens colipase like 1 (CLPSL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLPSL1 (340204)
Length:
578
CDS:
148..450

Additional Resources:

NCBI RefSeq record:
XM_017010821.1
NBCI Gene record:
CLPSL1 (340204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05469 pDONR223 100% 46.2% 35.9% None (many diffs) n/a
2 ccsbBroad304_05469 pLX_304 0% 46.2% 35.9% V5 (many diffs) n/a
3 TRCN0000475797 TTACTGGTTTAACGATTTGGTCTT pLX_317 55.9% 46.2% 35.9% V5 (many diffs) n/a
Download CSV