Transcript: Human XM_017011010.1

PREDICTED: Homo sapiens capping protein regulator and myosin 1 linker 1 (CARMIL1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CARMIL1 (55604)
Length:
5599
CDS:
369..4652

Additional Resources:

NCBI RefSeq record:
XM_017011010.1
NBCI Gene record:
CARMIL1 (55604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423229 TGGAACACTTTACCAAGTTAA pLKO_005 3331 CDS 100% 13.200 10.560 N CARMIL1 n/a
2 TRCN0000427797 TTAATGAAAGCCAGCAATTAT pLKO_005 4928 3UTR 100% 15.000 10.500 N CARMIL1 n/a
3 TRCN0000420716 CAATGGGATGTGGATACAATT pLKO_005 903 CDS 100% 13.200 9.240 N CARMIL1 n/a
4 TRCN0000163342 GCTGAGGAGAAGCCAGTTAAA pLKO.1 3024 CDS 100% 13.200 9.240 N CARMIL1 n/a
5 TRCN0000162103 CCCAGGAGTATCAAGAACAAA pLKO.1 4543 CDS 100% 5.625 3.938 N CARMIL1 n/a
6 TRCN0000160725 CCAGCAGATGATTGACAGAAT pLKO.1 2429 CDS 100% 4.950 3.465 N CARMIL1 n/a
7 TRCN0000163234 GCACTCTCACATTGCCATCAT pLKO.1 2934 CDS 100% 4.950 3.465 N CARMIL1 n/a
8 TRCN0000161672 GCTGAGAATCTTTGTCCCAAT pLKO.1 2724 CDS 100% 4.050 2.835 N CARMIL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.