Transcript: Human XM_017011070.1

PREDICTED: Homo sapiens TUB like protein 4 (TULP4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TULP4 (56995)
Length:
11800
CDS:
2035..6666

Additional Resources:

NCBI RefSeq record:
XM_017011070.1
NBCI Gene record:
TULP4 (56995)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234612 ACCTCGGTGCAGTAATCTATA pLKO_005 3893 CDS 100% 13.200 18.480 N TULP4 n/a
2 TRCN0000234613 AGGTCCAGGTGACGAAGATAA pLKO_005 4508 CDS 100% 13.200 18.480 N TULP4 n/a
3 TRCN0000234611 CTTGCTCAGGTCACGTCTAAT pLKO_005 3820 CDS 100% 13.200 18.480 N TULP4 n/a
4 TRCN0000234614 CCATATCCAGGAAGCTATAAC pLKO_005 5602 CDS 100% 13.200 10.560 N TULP4 n/a
5 TRCN0000234615 AGTGTTCACCAGGGTATTAAA pLKO_005 7829 3UTR 100% 15.000 10.500 N TULP4 n/a
6 TRCN0000016976 CCTGTCTTCAACCCAAATGTT pLKO.1 4000 CDS 100% 5.625 3.938 N TULP4 n/a
7 TRCN0000016977 CCAACTGAAGTCAAAGAAGTT pLKO.1 6201 CDS 100% 4.950 3.465 N TULP4 n/a
8 TRCN0000016975 CCGAACAACATGAGAGACTTT pLKO.1 3301 CDS 100% 4.950 3.465 N TULP4 n/a
9 TRCN0000016973 GCTAGGACTTTGAGTGACTTT pLKO.1 6118 CDS 100% 4.950 3.465 N TULP4 n/a
10 TRCN0000016974 GCCACTTTCCAAACAGGCTAT pLKO.1 5569 CDS 100% 4.050 2.835 N TULP4 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9119 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9119 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.