Transcript: Human XM_017011107.2

PREDICTED: Homo sapiens AT-rich interaction domain 1B (ARID1B), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARID1B (57492)
Length:
7019
CDS:
77..6847

Additional Resources:

NCBI RefSeq record:
XM_017011107.2
NBCI Gene record:
ARID1B (57492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415830 TGGTCACGTTGGCCAACATTT pLKO_005 6171 CDS 100% 13.200 18.480 N ARID1B n/a
2 TRCN0000107361 GCCGAATTACAAACGCCATAT pLKO.1 4204 CDS 100% 10.800 15.120 N ARID1B n/a
3 TRCN0000107362 GCCGTCTATGAAGATGCAGAA pLKO.1 4822 CDS 100% 4.050 5.670 N ARID1B n/a
4 TRCN0000416443 GGGTTTGGCCCAGGTTAATAA pLKO_005 3430 CDS 100% 15.000 12.000 N ARID1B n/a
5 TRCN0000424323 GTGGGCTTTGGACACTATTAA pLKO_005 5053 CDS 100% 15.000 10.500 N ARID1B n/a
6 TRCN0000420576 GAAGATTAGAGGGTCACATAT pLKO_005 6877 3UTR 100% 13.200 9.240 N ARID1B n/a
7 TRCN0000107364 GCACGCAATGATATGCCTTAT pLKO.1 4496 CDS 100% 10.800 7.560 N ARID1B n/a
8 TRCN0000107363 GCAGTATATTCAGTACCTGTT pLKO.1 3526 CDS 100% 4.050 2.835 N ARID1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.