Transcript: Human XM_017011155.2

PREDICTED: Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REV3L (5980)
Length:
7116
CDS:
297..7061

Additional Resources:

NCBI RefSeq record:
XM_017011155.2
NBCI Gene record:
REV3L (5980)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244440 CTAGTGATATCTCCAATTAAT pLKO_005 6837 CDS 100% 0.000 0.000 N REV3L n/a
2 TRCN0000053125 CGGAGCCATAATGAATAAATT pLKO.1 722 CDS 100% 15.000 12.000 N REV3L n/a
3 TRCN0000244437 CTGATGAAAGTGGACTAAATA pLKO_005 2590 CDS 100% 15.000 10.500 N REV3L n/a
4 TRCN0000244436 TGACCTGTCTGAGACTATTTA pLKO_005 5990 CDS 100% 15.000 10.500 N REV3L n/a
5 TRCN0000053127 GCTGAGTTTGAGGGAGACTTT pLKO.1 6111 CDS 100% 4.950 3.465 N REV3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.