Transcript: Human XM_017011235.2

PREDICTED: Homo sapiens transcription factor AP-2 beta (TFAP2B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFAP2B (7021)
Length:
5590
CDS:
440..1363

Additional Resources:

NCBI RefSeq record:
XM_017011235.2
NBCI Gene record:
TFAP2B (7021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415521 ACATTTGCGAAACGGAGTTTC pLKO_005 954 CDS 100% 10.800 15.120 N TFAP2B n/a
2 TRCN0000415320 GCGTACAACGGAGCAACAATA pLKO_005 1536 3UTR 100% 13.200 10.560 N TFAP2B n/a
3 TRCN0000436571 TTGGACCAGTCTGTCATTAAA pLKO_005 557 CDS 100% 15.000 10.500 N TFAP2B n/a
4 TRCN0000428391 CAAAGCCGTCTCTGAGTATTT pLKO_005 979 CDS 100% 13.200 9.240 N TFAP2B n/a
5 TRCN0000420505 GTTCAACTTCGAAGTACAAAG pLKO_005 702 CDS 100% 10.800 7.560 N TFAP2B n/a
6 TRCN0000433281 TGGAGACAACCGTCCGGATTT pLKO_005 1588 3UTR 100% 10.800 7.560 N TFAP2B n/a
7 TRCN0000019659 CGGTTCTTTCGAGTTTAGTAA pLKO.1 1616 3UTR 100% 5.625 3.938 N TFAP2B n/a
8 TRCN0000019661 CTCCCGAAAGAATATGCTGTT pLKO.1 1033 CDS 100% 4.050 2.835 N TFAP2B n/a
9 TRCN0000019663 GCTGTTCACTTAGCTAGGGAT pLKO.1 926 CDS 100% 2.640 1.848 N TFAP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.