Transcript: Human XM_017011263.1

PREDICTED: Homo sapiens tripartite motif containing 26 (TRIM26), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM26 (7726)
Length:
3097
CDS:
286..1674

Additional Resources:

NCBI RefSeq record:
XM_017011263.1
NBCI Gene record:
TRIM26 (7726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427253 GAACCACCTGAGTACCCTAAG pLKO_005 735 CDS 100% 6.000 8.400 N TRIM26 n/a
2 TRCN0000433005 CAATTACGCCTAAGATCATTT pLKO_005 2041 3UTR 100% 13.200 10.560 N TRIM26 n/a
3 TRCN0000425384 GACACGAGAGACTTCCTAAAC pLKO_005 820 CDS 100% 10.800 8.640 N TRIM26 n/a
4 TRCN0000004049 GCTGAGAGACTTGGAATATAA pLKO.1 966 CDS 100% 15.000 10.500 N TRIM26 n/a
5 TRCN0000004050 GCTGCTGAGAGACTTGGAATA pLKO.1 963 CDS 100% 10.800 7.560 N TRIM26 n/a
6 TRCN0000004048 CTGGAGCTATCTGTGGTCTTA pLKO.1 2328 3UTR 100% 4.950 3.465 N TRIM26 n/a
7 TRCN0000004047 ACACCGAGAGAAGCTGCACTA pLKO.1 597 CDS 100% 4.050 2.835 N TRIM26 n/a
8 TRCN0000004051 GATGGATATGACGACTGGGAA pLKO.1 1267 CDS 100% 2.640 1.848 N TRIM26 n/a
9 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1322 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.