Transcript: Human XM_017011958.2

PREDICTED: Homo sapiens STEAP2 metalloreductase (STEAP2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STEAP2 (261729)
Length:
5736
CDS:
4168..5523

Additional Resources:

NCBI RefSeq record:
XM_017011958.2
NBCI Gene record:
STEAP2 (261729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064091 GCGCGACAACAGGTTATTGAA pLKO.1 4687 CDS 100% 5.625 7.875 N STEAP2 n/a
2 TRCN0000286948 GCGCGACAACAGGTTATTGAA pLKO_005 4687 CDS 100% 5.625 7.875 N STEAP2 n/a
3 TRCN0000064090 CGACTTATTAGATGCGGCTAT pLKO.1 4309 CDS 100% 4.050 5.670 N STEAP2 n/a
4 TRCN0000064088 CCAGATTCTTTGATTGTCAAA pLKO.1 4579 CDS 100% 4.950 3.960 N STEAP2 n/a
5 TRCN0000064089 CGGCACCAAGTATAGGAGATT pLKO.1 5019 CDS 100% 4.950 3.960 N STEAP2 n/a
6 TRCN0000294357 GCCAGTGGTGGTAGCTATAAG pLKO_005 4809 CDS 100% 13.200 9.240 N STEAP2 n/a
7 TRCN0000294301 TATATCTCCTTTGGCATAATG pLKO_005 5245 CDS 100% 13.200 9.240 N STEAP2 n/a
8 TRCN0000253447 ATGGCATAAATGGTATCAAAG pLKO_005 4226 CDS 100% 10.800 7.560 N Steap2 n/a
9 TRCN0000294338 ATGGCATAAATGGTATCAAAG pLKO_005 4226 CDS 100% 10.800 7.560 N STEAP2 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3526 5UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000064092 CCTCAATTGTAATTCTGGGTA pLKO.1 5483 CDS 100% 2.640 3.696 N STEAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.