Transcript: Human XM_017012150.1

PREDICTED: Homo sapiens stimulated by retinoic acid 8 (STRA8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRA8 (346673)
Length:
2200
CDS:
707..1426

Additional Resources:

NCBI RefSeq record:
XM_017012150.1
NBCI Gene record:
STRA8 (346673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435498 ACTCTCAGTCTGATCTCATAG pLKO_005 870 CDS 100% 10.800 7.560 N STRA8 n/a
2 TRCN0000128429 GAAAGAATATGCCAGCATGTA pLKO.1 1024 CDS 100% 4.950 3.465 N STRA8 n/a
3 TRCN0000129047 GAAGCTGAAAGCATCCTTCAA pLKO.1 964 CDS 100% 4.950 3.465 N STRA8 n/a
4 TRCN0000127825 GCATCCTTCAACCTGGAAGAT pLKO.1 974 CDS 100% 4.950 3.465 N STRA8 n/a
5 TRCN0000128946 CATATTCCAGAACTGGAGCAA pLKO.1 926 CDS 100% 2.640 1.848 N STRA8 n/a
6 TRCN0000130385 GAGTCATATTCCAGAACTGGA pLKO.1 922 CDS 100% 2.640 1.848 N STRA8 n/a
7 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1169 CDS 100% 4.950 2.475 Y PTMA n/a
8 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1206 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.