Transcript: Human XM_017012195.1

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily H member 2 (KCNH2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNH2 (3757)
Length:
4371
CDS:
633..3962

Additional Resources:

NCBI RefSeq record:
XM_017012195.1
NBCI Gene record:
KCNH2 (3757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021714 CCTGCGAGATACCAACATGAT pLKO.1 3065 CDS 100% 4.950 6.930 N KCNH2 n/a
2 TRCN0000422341 GAGGGCATTAGCTGGTCTAAC pLKO_005 4195 3UTR 100% 10.800 7.560 N KCNH2 n/a
3 TRCN0000068385 CCCTCCATCAAGGACAAGTAT pLKO.1 2295 CDS 100% 5.625 3.938 N Kcnh2 n/a
4 TRCN0000429152 CAGATAGGCAAACCCTACAAC pLKO_005 2256 CDS 100% 4.950 3.465 N KCNH2 n/a
5 TRCN0000021716 CCGTGAGATCATAGCACCTAA pLKO.1 1547 CDS 100% 4.950 3.465 N KCNH2 n/a
6 TRCN0000021717 CCTCATGTATGCTAGCATCTT pLKO.1 2429 CDS 100% 4.950 3.465 N KCNH2 n/a
7 TRCN0000436356 CTCACCTTGGACTCGCTTTCT pLKO_005 3789 CDS 100% 4.950 3.465 N KCNH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.