Transcript: Human XM_017012522.1

PREDICTED: Homo sapiens WAS/WASL interacting protein family member 3 (WIPF3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WIPF3 (644150)
Length:
4191
CDS:
224..1642

Additional Resources:

NCBI RefSeq record:
XM_017012522.1
NBCI Gene record:
WIPF3 (644150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255437 CCGCAGATCGAGAGTTCTAAA pLKO_005 401 CDS 100% 13.200 18.480 N WIPF3 n/a
2 TRCN0000255436 GAGTGCGCTGTTGGCTGATAT pLKO_005 328 CDS 100% 13.200 9.240 N WIPF3 n/a
3 TRCN0000265646 CCTGGAGGTCAACTGCGAAAT pLKO_005 1400 CDS 100% 10.800 7.560 N WIPF3 n/a
4 TRCN0000255439 ATTGATGACTTCGAGTCTAAA pLKO_005 1436 CDS 100% 13.200 7.920 N WIPF3 n/a
5 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3653 3UTR 100% 4.950 2.475 Y LOC339059 n/a
6 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3709 3UTR 100% 4.950 2.475 Y ERN2 n/a
7 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3709 3UTR 100% 4.950 2.475 Y P3H4 n/a
8 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3709 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.