Transcript: Human XM_017012530.2

PREDICTED: Homo sapiens GRB10 interacting GYF protein 1 (GIGYF1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GIGYF1 (64599)
Length:
5971
CDS:
560..3790

Additional Resources:

NCBI RefSeq record:
XM_017012530.2
NBCI Gene record:
GIGYF1 (64599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420791 CTTTGGGACATACCAATTAAC pLKO_005 2543 CDS 100% 13.200 18.480 N GIGYF1 n/a
2 TRCN0000421422 TTCGACTCAGGGTCCAATTCT pLKO_005 2566 CDS 100% 5.625 7.875 N GIGYF1 n/a
3 TRCN0000421771 ACTCCAGCTGCAACATAAATT pLKO_005 2593 CDS 100% 15.000 10.500 N GIGYF1 n/a
4 TRCN0000437314 AGCTGGCTGACTACCGTTATG pLKO_005 663 CDS 100% 10.800 7.560 N GIGYF1 n/a
5 TRCN0000415559 AGGATAGTGGGTGTGACAATG pLKO_005 4055 3UTR 100% 10.800 7.560 N GIGYF1 n/a
6 TRCN0000340968 CTTCGACTCAGGGTCCAATTC pLKO_005 2565 CDS 100% 10.800 7.560 N Gigyf1 n/a
7 TRCN0000167024 CCAAAGAATTTGCCAAACAAT pLKO.1 3411 CDS 100% 5.625 3.938 N GIGYF1 n/a
8 TRCN0000172836 GTGACTCATACAGCCACCTAT pLKO.1 3159 CDS 100% 4.950 3.465 N GIGYF1 n/a
9 TRCN0000438856 GCGGTTTGAGAAGTCAGCAAG pLKO_005 1051 CDS 100% 4.050 2.835 N GIGYF1 n/a
10 TRCN0000182148 CCAGTCTTTGGGACATACCAA pLKO.1 2538 CDS 100% 3.000 2.100 N Gigyf1 n/a
11 TRCN0000172837 GATCTTCTGGTGAGATCGAGA pLKO.1 3722 CDS 100% 0.264 0.185 N GIGYF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.