Transcript: Human XM_017012657.2

PREDICTED: Homo sapiens endonuclease/exonuclease/phosphatase family domain containing 1 (EEPD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EEPD1 (80820)
Length:
1710
CDS:
616..1575

Additional Resources:

NCBI RefSeq record:
XM_017012657.2
NBCI Gene record:
EEPD1 (80820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245041 TCGTGGAGTACCGAGAGTATA pLKO_005 806 CDS 100% 13.200 18.480 N EEPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09051 pDONR223 100% 54.7% 51.6% None (many diffs) n/a
2 ccsbBroad304_09051 pLX_304 0% 54.7% 51.6% V5 (many diffs) n/a
3 TRCN0000477234 CGGCGCACTATTAAAGCTTTATCG pLX_317 19.6% 54.7% 51.6% V5 (many diffs) n/a
Download CSV