Transcript: Human XM_017012720.2

PREDICTED: Homo sapiens chromosome 7 open reading frame 50 (C7orf50), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C7orf50 (84310)
Length:
1199
CDS:
63..740

Additional Resources:

NCBI RefSeq record:
XM_017012720.2
NBCI Gene record:
C7orf50 (84310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263542 AGTGACAAGGTTCCCGATGAG pLKO_005 459 CDS 100% 4.050 5.670 N C7orf50 n/a
2 TRCN0000263543 GCACAAGAACTGGAGGTTTCA pLKO_005 398 CDS 100% 4.950 3.960 N C7orf50 n/a
3 TRCN0000179374 GCACATGTATGACAGTGACAA pLKO.1 446 CDS 100% 4.950 3.465 N C7orf50 n/a
4 TRCN0000369565 CACATGTATGACAGTGACAAG pLKO_005 447 CDS 100% 4.050 2.835 N C7orf50 n/a
5 TRCN0000263539 TGGCTCCTGCTGCACATGTAT pLKO_005 435 CDS 100% 5.625 3.375 N C7orf50 n/a
6 TRCN0000263540 GTCCTGGAAAGGAAGCTGAAA pLKO_005 255 CDS 100% 4.950 2.970 N C7orf50 n/a
7 TRCN0000266915 CTCCTGCTGCACATGTATGAT pLKO_005 438 CDS 100% 5.625 3.938 N 3110082I17Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.