Transcript: Human XM_017013948.1

PREDICTED: Homo sapiens family with sequence similarity 110 member B (FAM110B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM110B (90362)
Length:
6003
CDS:
3450..4562

Additional Resources:

NCBI RefSeq record:
XM_017013948.1
NBCI Gene record:
FAM110B (90362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412739 GGTATACAACTTCTTCGATAT pLKO_005 4833 3UTR 100% 10.800 15.120 N FAM110B n/a
2 TRCN0000116208 GCTAGAATCATCAAGTGGTTA pLKO.1 4494 CDS 100% 4.950 6.930 N FAM110B n/a
3 TRCN0000116211 CAGACTTGAGTGACAGATATT pLKO.1 4231 CDS 100% 13.200 10.560 N FAM110B n/a
4 TRCN0000116210 CATCGAAAGAAATGCTAGAAT pLKO.1 4481 CDS 100% 5.625 4.500 N FAM110B n/a
5 TRCN0000427098 AGTAACAGTGACCTTAGAAAT pLKO_005 4419 CDS 100% 13.200 9.240 N Fam110b n/a
6 TRCN0000116207 CGACAGAATGACCACCCTAAA pLKO.1 5319 3UTR 100% 10.800 7.560 N FAM110B n/a
7 TRCN0000417416 TGTAAGACAGTGCGTGGAAAG pLKO_005 4558 CDS 100% 6.000 4.200 N FAM110B n/a
8 TRCN0000116209 GCAAGGGCTAATTCTGACATA pLKO.1 4338 CDS 100% 4.950 3.465 N FAM110B n/a
9 TRCN0000181553 GCATCAAACAAGCTAGAGAGT pLKO.1 4519 CDS 100% 2.640 1.848 N Fam110b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09293 pDONR223 100% 99.9% 100% None 936C>T n/a
2 ccsbBroad304_09293 pLX_304 0% 99.9% 100% V5 936C>T n/a
Download CSV