Transcript: Human XM_017014260.1

PREDICTED: Homo sapiens ciliary neurotrophic factor receptor (CNTFR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTFR (1271)
Length:
2268
CDS:
310..1629

Additional Resources:

NCBI RefSeq record:
XM_017014260.1
NBCI Gene record:
CNTFR (1271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059255 CATTCGCTACATGCACCTGTT pLKO.1 1005 CDS 100% 4.050 5.670 N CNTFR n/a
2 TRCN0000066978 CATTCTCTTCAGACACAATTT pLKO.1 1738 3UTR 100% 13.200 9.240 N Cntfr n/a
3 TRCN0000059253 GCATTCTCTTCAGACACAATT pLKO.1 1737 3UTR 100% 13.200 9.240 N CNTFR n/a
4 TRCN0000423206 GCCGGGAAGGAGTACATTATC pLKO_005 1324 CDS 100% 13.200 9.240 N CNTFR n/a
5 TRCN0000428987 ACATTCCCAACACCTTCAATG pLKO_005 917 CDS 100% 10.800 7.560 N CNTFR n/a
6 TRCN0000059254 GCAGCCAAGGACAATGAGATT pLKO.1 1351 CDS 100% 4.950 3.465 N CNTFR n/a
7 TRCN0000059256 CATCAAGTACAAGGTCTCCAT pLKO.1 1032 CDS 100% 2.640 1.848 N CNTFR n/a
8 TRCN0000059257 TCTCAAGTTCTTTCTGCGCTA pLKO.1 1227 CDS 100% 2.160 1.512 N CNTFR n/a
9 TRCN0000431852 GAGCCTCTCACATCCGATTTC pLKO_005 1945 3UTR 100% 10.800 6.480 N CNTFR n/a
10 TRCN0000426107 ATGCCACAGCTATCACCTTTG pLKO_005 1079 CDS 100% 6.000 3.600 N CNTFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00341 pDONR223 100% 84.7% 84.7% None 1_201del n/a
2 ccsbBroad304_00341 pLX_304 0% 84.7% 84.7% V5 1_201del n/a
Download CSV