Transcript: Human XM_017014319.2

PREDICTED: Homo sapiens FRAS1 related extracellular matrix 1 (FREM1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FREM1 (158326)
Length:
10553
CDS:
1262..7828

Additional Resources:

NCBI RefSeq record:
XM_017014319.2
NBCI Gene record:
FREM1 (158326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372276 GGGCGATCTCCATACCTTAAA pLKO_005 3808 CDS 100% 13.200 18.480 N FREM1 n/a
2 TRCN0000074120 CGAATATGAAGTCTGTGAGAA pLKO.1 6532 CDS 100% 4.950 6.930 N FREM1 n/a
3 TRCN0000074119 GCTACGGGATTTACATCACTT pLKO.1 6225 CDS 100% 4.950 6.930 N FREM1 n/a
4 TRCN0000074122 GTGGGTATAAAGGTCAACCAA pLKO.1 6611 CDS 100% 3.000 4.200 N FREM1 n/a
5 TRCN0000372334 TATGGGTGAAACTCGTATTAT pLKO_005 5149 CDS 100% 15.000 10.500 N FREM1 n/a
6 TRCN0000372275 TTCGTGGTCTTCCGGATATTT pLKO_005 2768 CDS 100% 15.000 10.500 N FREM1 n/a
7 TRCN0000074121 AGGTGAATTTATCCATGAGAA pLKO.1 6346 CDS 100% 4.950 3.465 N FREM1 n/a
8 TRCN0000074118 CCATCTAAACTGATTCAGTTT pLKO.1 6668 CDS 100% 0.495 0.347 N FREM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.