Transcript: Human XM_017014376.2

PREDICTED: Homo sapiens extracellular matrix protein 2 (ECM2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ECM2 (1842)
Length:
2461
CDS:
319..1776

Additional Resources:

NCBI RefSeq record:
XM_017014376.2
NBCI Gene record:
ECM2 (1842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157144 GCACTTCAATCTGAGGAGGAT pLKO.1 946 CDS 100% 2.640 3.696 N ECM2 n/a
2 TRCN0000153739 CCAGTAGCAAGACTTCCTATT pLKO.1 505 CDS 100% 10.800 8.640 N ECM2 n/a
3 TRCN0000435267 CAAAGAGAACCTACCAATTTA pLKO_005 868 CDS 100% 15.000 10.500 N ECM2 n/a
4 TRCN0000153436 CCTATTCTCTACTCAGTGGTA pLKO.1 803 CDS 100% 2.640 1.848 N ECM2 n/a
5 TRCN0000157442 GCACAGATCAAACAGACAGCT pLKO.1 456 CDS 100% 2.640 1.848 N ECM2 n/a
6 TRCN0000153011 GCTCAGATGGAAGAGTTCTTT pLKO.1 695 CDS 100% 5.625 3.375 N ECM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.