Transcript: Human XM_017014499.2

PREDICTED: Homo sapiens lysine demethylase 4C (KDM4C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM4C (23081)
Length:
5156
CDS:
1388..4237

Additional Resources:

NCBI RefSeq record:
XM_017014499.2
NBCI Gene record:
KDM4C (23081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257272 CAGCGGGTAGGGCGATAATTT pLKO_005 4639 3UTR 100% 15.000 21.000 N KDM4C n/a
2 TRCN0000235047 ATACTTGGATTACGAAGATTT pLKO_005 1139 5UTR 100% 13.200 18.480 N KDM4C n/a
3 TRCN0000235050 CATCGGAACACCCGGTATTAC pLKO_005 3731 CDS 100% 13.200 18.480 N KDM4C n/a
4 TRCN0000022056 GCCTCTGACATGCGATTTGAA pLKO.1 4067 CDS 100% 5.625 7.875 N KDM4C n/a
5 TRCN0000022054 GCCCAAGTCTTGGTATGCTAT pLKO.1 1585 CDS 100% 4.950 6.930 N KDM4C n/a
6 TRCN0000022057 GCACCTATCTATGGTGCAGAT pLKO.1 1194 5UTR 100% 0.405 0.567 N KDM4C n/a
7 TRCN0000235049 CATTACATGCTTTCGACATAA pLKO_005 3541 CDS 100% 13.200 9.240 N KDM4C n/a
8 TRCN0000235048 GCTATGAGAAGCCCGAGAAAT pLKO_005 2445 CDS 100% 13.200 9.240 N KDM4C n/a
9 TRCN0000022055 CCTTGCATACATGGAGTCTAA pLKO.1 899 5UTR 100% 4.950 3.465 N KDM4C n/a
10 TRCN0000022058 GCAGAGAGTAATGGTGTGTTA pLKO.1 2519 CDS 100% 4.950 3.465 N KDM4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.