Transcript: Human XM_017014637.2

PREDICTED: Homo sapiens Rap guanine nucleotide exchange factor 1 (RAPGEF1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAPGEF1 (2889)
Length:
6581
CDS:
177..3854

Additional Resources:

NCBI RefSeq record:
XM_017014637.2
NBCI Gene record:
RAPGEF1 (2889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048128 CGGAGGAACGACGACATTATA pLKO.1 3717 CDS 100% 15.000 21.000 N RAPGEF1 n/a
2 TRCN0000300241 CGGAGGAACGACGACATTATA pLKO_005 3717 CDS 100% 15.000 21.000 N RAPGEF1 n/a
3 TRCN0000048130 CGAGGTAGAGATCCTAAACAA pLKO.1 986 CDS 100% 5.625 7.875 N RAPGEF1 n/a
4 TRCN0000300242 CGAGGTAGAGATCCTAAACAA pLKO_005 986 CDS 100% 5.625 7.875 N RAPGEF1 n/a
5 TRCN0000048132 CCTGCGCTACTTTAAGACCAT pLKO.1 578 CDS 100% 2.640 3.696 N RAPGEF1 n/a
6 TRCN0000310599 CCTGCGCTACTTTAAGACCAT pLKO_005 578 CDS 100% 2.640 3.696 N RAPGEF1 n/a
7 TRCN0000048129 CGTCAGCAAGAACACGTTCTT pLKO.1 2879 CDS 100% 0.495 0.396 N RAPGEF1 n/a
8 TRCN0000300240 CGTCAGCAAGAACACGTTCTT pLKO_005 2879 CDS 100% 0.495 0.396 N RAPGEF1 n/a
9 TRCN0000048131 GCTGAATAACTTCAACTCCTA pLKO.1 3386 CDS 100% 2.640 1.584 N RAPGEF1 n/a
10 TRCN0000300244 GCTGAATAACTTCAACTCCTA pLKO_005 3386 CDS 100% 2.640 1.584 N RAPGEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.