Transcript: Human XM_017014784.2

PREDICTED: Homo sapiens pappalysin 1 (PAPPA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAPPA (5069)
Length:
10896
CDS:
422..5191

Additional Resources:

NCBI RefSeq record:
XM_017014784.2
NBCI Gene record:
PAPPA (5069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430558 TTGGCAGTGTGTACCAGTATT pLKO_005 3165 CDS 100% 13.200 18.480 N PAPPA n/a
2 TRCN0000046708 CGGACAGACATTGTGTGACAA pLKO.1 1402 CDS 100% 4.950 3.960 N PAPPA n/a
3 TRCN0000413391 GGTGACGGATGGGACATATTA pLKO_005 3616 CDS 100% 15.000 10.500 N PAPPA n/a
4 TRCN0000046712 CCTACATCTCAATAGGAAATT pLKO.1 3124 CDS 100% 13.200 9.240 N PAPPA n/a
5 TRCN0000415965 GAACAAGTGGGTGGCATATTC pLKO_005 1085 CDS 100% 13.200 9.240 N PAPPA n/a
6 TRCN0000341056 TGAACCCAGCCGGTGCTATTT pLKO_005 3376 CDS 100% 13.200 9.240 N Pappa n/a
7 TRCN0000413577 ACGACATGAATAAGATCAATG pLKO_005 3303 CDS 100% 10.800 7.560 N PAPPA n/a
8 TRCN0000046710 GCTGTATGACAAATGTTCTTA pLKO.1 838 CDS 100% 5.625 3.938 N PAPPA n/a
9 TRCN0000046711 CCATTCCCTATGTCCTGTGAT pLKO.1 5090 CDS 100% 4.950 3.465 N PAPPA n/a
10 TRCN0000046709 GCCATTTCTTTGAAAGAGAAT pLKO.1 2517 CDS 100% 4.950 3.465 N PAPPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.