Transcript: Human XM_017014963.2

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type D (PTPRD), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRD (5789)
Length:
9091
CDS:
1042..6837

Additional Resources:

NCBI RefSeq record:
XM_017014963.2
NBCI Gene record:
PTPRD (5789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355657 AGATACCACATACGATGTAAA pLKO_005 3999 CDS 100% 13.200 18.480 N PTPRD n/a
2 TRCN0000342210 TAAGTCCCTACTCGGATTATG pLKO_005 2189 CDS 100% 13.200 18.480 N Ptprd n/a
3 TRCN0000355692 TAAGTCCCTACTCGGATTATG pLKO_005 2189 CDS 100% 13.200 18.480 N PTPRD n/a
4 TRCN0000002854 CCAAAGAATAGATACGCGAAT pLKO.1 5242 CDS 100% 4.050 5.670 N PTPRD n/a
5 TRCN0000355656 ATTCCGCTCCTGCCAATTTAT pLKO_005 1691 CDS 100% 15.000 10.500 N PTPRD n/a
6 TRCN0000002851 GCCAATCTTCCATGTAATAAA pLKO.1 6088 CDS 100% 15.000 10.500 N PTPRD n/a
7 TRCN0000002852 CCCACCCACTAATCATGAAAT pLKO.1 1761 CDS 100% 13.200 9.240 N PTPRD n/a
8 TRCN0000002853 CCTGAGTCTGAAACAAGTATT pLKO.1 2617 CDS 100% 13.200 9.240 N PTPRD n/a
9 TRCN0000002850 CTTCCCACCATACTGCTCATA pLKO.1 7262 3UTR 100% 4.950 3.465 N PTPRD n/a
10 TRCN0000081272 CCACTAAACTTCAAAGCAGAA pLKO.1 2596 CDS 100% 4.050 2.835 N LOC433880 n/a
11 TRCN0000081269 GAGAAGTTGAATTAAAGCCAT pLKO.1 4595 CDS 100% 2.640 1.848 N LOC433880 n/a
12 TRCN0000197657 CAGAGATTTGAGGTAATAGAA pLKO.1 1240 CDS 100% 5.625 3.938 N Ptprd n/a
13 TRCN0000182394 GCGTTGGAAGAACTGGAGTTT pLKO.1 6638 CDS 100% 4.950 2.970 N Ptprd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.