Transcript: Human XM_017015242.2

PREDICTED: Homo sapiens cell division cycle 14B (CDC14B), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC14B (8555)
Length:
5273
CDS:
69..1631

Additional Resources:

NCBI RefSeq record:
XM_017015242.2
NBCI Gene record:
CDC14B (8555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010980 CCAAATAATGTCGGCTTACAA pLKO.1 2499 3UTR 100% 5.625 7.875 N CDC14B n/a
2 TRCN0000381974 GTGATAGACTTCGGGCCTTGA pLKO_005 1351 CDS 100% 4.050 5.670 N CDC14B n/a
3 TRCN0000273399 ATCATCTTCACTTGACTATTT pLKO_005 2114 3UTR 100% 13.200 9.240 N CDC14B n/a
4 TRCN0000380135 ACTGATGCCATTGTCAAAGAA pLKO_005 942 CDS 100% 5.625 3.375 N CDC14B n/a
5 TRCN0000005979 CTCCTGAGACTTATATTCAAT pLKO.1 799 CDS 100% 5.625 3.375 N CDC14B n/a
6 TRCN0000273454 CTCCTGAGACTTATATTCAAT pLKO_005 799 CDS 100% 5.625 3.375 N CDC14B n/a
7 TRCN0000273457 CACAATGTTACTACCATTATT pLKO_005 831 CDS 100% 15.000 7.500 Y CDC14B n/a
8 TRCN0000273455 TTGGATGCTACATGGTTATAT pLKO_005 475 CDS 100% 15.000 7.500 Y CDC14B n/a
9 TRCN0000005977 CTCTCCATTTCAAGGACTAAA pLKO.1 1596 CDS 100% 13.200 6.600 Y CDC14B n/a
10 TRCN0000005978 GAGTGCATCAAATGTACATTA pLKO.1 266 CDS 100% 13.200 6.600 Y CDC14B n/a
11 TRCN0000284982 GGATAATACCAGACCGATTTA pLKO_005 721 CDS 100% 13.200 6.600 Y CDC14B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.