Transcript: Human XM_017015319.2

PREDICTED: Homo sapiens phospholipase A2 activating protein (PLAA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLAA (9373)
Length:
3184
CDS:
223..1827

Additional Resources:

NCBI RefSeq record:
XM_017015319.2
NBCI Gene record:
PLAA (9373)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047186 GCGAGTGTCTTGAAGTATATT pLKO.1 884 CDS 100% 15.000 10.500 N PLAA n/a
2 TRCN0000299375 GCGAGTGTCTTGAAGTATATT pLKO_005 884 CDS 100% 15.000 10.500 N PLAA n/a
3 TRCN0000303689 TGAAGGTGGACCATCATATAA pLKO_005 1452 CDS 100% 15.000 10.500 N PLAA n/a
4 TRCN0000047184 CCGGTGGAAATGACCACAATA pLKO.1 482 CDS 100% 13.200 9.240 N PLAA n/a
5 TRCN0000047187 CCTATGTTTCTGGATCAAGTA pLKO.1 1543 CDS 100% 4.950 3.465 N PLAA n/a
6 TRCN0000299374 CCTATGTTTCTGGATCAAGTA pLKO_005 1543 CDS 100% 4.950 3.465 N PLAA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07404 pDONR223 100% 61.2% 60.7% None (many diffs) n/a
2 ccsbBroad304_07404 pLX_304 0% 61.2% 60.7% V5 (many diffs) n/a
Download CSV