Transcript: Human XM_017015352.2

PREDICTED: Homo sapiens tripartite motif containing 14 (TRIM14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM14 (9830)
Length:
1742
CDS:
233..1561

Additional Resources:

NCBI RefSeq record:
XM_017015352.2
NBCI Gene record:
TRIM14 (9830)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061828 GCCCGTCAAGAGCTTCTTTAA pLKO.1 850 CDS 100% 13.200 18.480 N TRIM14 n/a
2 TRCN0000061829 GCGATCGCTATTGCTGAAATA pLKO.1 1006 CDS 100% 13.200 18.480 N TRIM14 n/a
3 TRCN0000415906 GAAGCCGTGGAGAGTACATTA pLKO_005 881 CDS 100% 13.200 9.240 N TRIM14 n/a
4 TRCN0000061830 GCTAATGCAGAGTCAAGTAAA pLKO.1 536 CDS 100% 13.200 9.240 N TRIM14 n/a
5 TRCN0000061831 GCCATTGGACATTCGCCTTAA pLKO.1 907 CDS 100% 10.800 7.560 N TRIM14 n/a
6 TRCN0000412888 GACAACATAACCCAGATAGAA pLKO_005 494 CDS 100% 5.625 3.938 N TRIM14 n/a
7 TRCN0000061832 CTCAGATTACTACTTGACGAA pLKO.1 584 CDS 100% 2.640 1.848 N TRIM14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.