Transcript: Human XM_017015570.1

PREDICTED: Homo sapiens CUGBP Elav-like family member 2 (CELF2), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELF2 (10659)
Length:
8892
CDS:
575..1429

Additional Resources:

NCBI RefSeq record:
XM_017015570.1
NBCI Gene record:
CELF2 (10659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098679 CAACAAGATGAACGGAGCTTT pLKO.1 119 5UTR 100% 4.950 6.930 N Celf2 n/a
2 TRCN0000074615 CCACTGTTGGACTGAATAATA pLKO.1 930 CDS 100% 15.000 12.000 N CELF2 n/a
3 TRCN0000074617 GATCGGCATGAAACGCTTGAA pLKO.1 1366 CDS 100% 4.950 3.960 N CELF2 n/a
4 TRCN0000176651 CGTTCCTGATAAGTGAATAAA pLKO.1 8572 3UTR 100% 15.000 10.500 N Celf2 n/a
5 TRCN0000236113 TTTGACCACACAGGTTAATTT pLKO_005 7029 3UTR 100% 15.000 10.500 N CELF2 n/a
6 TRCN0000236112 TAGGAATGGTATCGAAGAAAT pLKO_005 377 5UTR 100% 13.200 9.240 N CELF2 n/a
7 TRCN0000074613 GCTCACTTTCTCATTAAGATA pLKO.1 3357 3UTR 100% 5.625 3.938 N CELF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.