Transcript: Human XM_017016311.2

PREDICTED: Homo sapiens phospholipase C epsilon 1 (PLCE1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCE1 (51196)
Length:
9695
CDS:
583..7533

Additional Resources:

NCBI RefSeq record:
XM_017016311.2
NBCI Gene record:
PLCE1 (51196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051067 GCGGATTATTGGAACTCACTA pLKO.1 3581 CDS 100% 4.950 3.960 N PLCE1 n/a
2 TRCN0000289427 GCGGATTATTGGAACTCACTA pLKO_005 3581 CDS 100% 4.950 3.960 N PLCE1 n/a
3 TRCN0000051065 GCTGCAATGTTTGAGGCAAAT pLKO.1 6103 CDS 100% 10.800 7.560 N PLCE1 n/a
4 TRCN0000289426 GCTGCAATGTTTGAGGCAAAT pLKO_005 6103 CDS 100% 10.800 7.560 N PLCE1 n/a
5 TRCN0000051064 CCATCATTTATCATGGACATA pLKO.1 4925 CDS 100% 4.950 3.465 N PLCE1 n/a
6 TRCN0000289424 CCATCATTTATCATGGACATA pLKO_005 4925 CDS 100% 4.950 3.465 N PLCE1 n/a
7 TRCN0000051066 CCACTTTGTTAGTCAGGAGAT pLKO.1 1547 CDS 100% 4.050 2.835 N PLCE1 n/a
8 TRCN0000289359 CCACTTTGTTAGTCAGGAGAT pLKO_005 1547 CDS 100% 4.050 2.835 N PLCE1 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9253 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7692 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 9421 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.