Transcript: Human XM_017016341.1

PREDICTED: Homo sapiens coiled-coil serine rich protein 2 (CCSER2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCSER2 (54462)
Length:
7212
CDS:
276..2207

Additional Resources:

NCBI RefSeq record:
XM_017016341.1
NBCI Gene record:
CCSER2 (54462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430752 CTTCATATTCTTCGATCAATA pLKO_005 757 CDS 100% 13.200 9.240 N CCSER2 n/a
2 TRCN0000429814 AGAACCAACAGCTATCCATTA pLKO_005 1039 CDS 100% 10.800 7.560 N CCSER2 n/a
3 TRCN0000426136 GCTCAAGAGCCTTATCATTTG pLKO_005 2417 3UTR 100% 10.800 7.560 N CCSER2 n/a
4 TRCN0000432774 TAATAGAGCTGTGGATCTTAC pLKO_005 1007 CDS 100% 10.800 7.560 N CCSER2 n/a
5 TRCN0000062106 CCCAGGTGTAACTTCTACTTT pLKO.1 1193 CDS 100% 5.625 3.938 N CCSER2 n/a
6 TRCN0000062107 CCAGAGGAAATGTCTCTCAAA pLKO.1 1566 CDS 100% 4.950 3.465 N CCSER2 n/a
7 TRCN0000062103 GCTGCTAATAAGGACCAAGAA pLKO.1 1353 CDS 100% 4.950 3.465 N CCSER2 n/a
8 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4286 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
9 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4359 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12042 pDONR223 100% 81% 78.5% None (many diffs) n/a
2 ccsbBroad304_12042 pLX_304 0% 81% 78.5% V5 (many diffs) n/a
Download CSV