Transcript: Human XM_017016360.1

PREDICTED: Homo sapiens WW domain binding protein 1 like (WBP1L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WBP1L (54838)
Length:
5635
CDS:
1920..2699

Additional Resources:

NCBI RefSeq record:
XM_017016360.1
NBCI Gene record:
WBP1L (54838)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136100 CCGTTGTATGATAGGTTGGTA pLKO.1 3252 3UTR 100% 3.000 4.200 N WBP1L n/a
2 TRCN0000135934 GAGTTCAACACACTCATCGAT pLKO.1 2472 CDS 100% 3.000 4.200 N WBP1L n/a
3 TRCN0000134189 CGATGATGATATTCAGACGAA pLKO.1 4194 3UTR 100% 2.640 3.696 N WBP1L n/a
4 TRCN0000275318 CGATGATGATATTCAGACGAA pLKO_005 4194 3UTR 100% 2.640 3.696 N WBP1L n/a
5 TRCN0000275362 TTACCGAGAAGCCCACAATTA pLKO_005 1658 5UTR 100% 13.200 9.240 N WBP1L n/a
6 TRCN0000275370 ACTATTTACTACCTCCTTATG pLKO_005 1975 CDS 100% 10.800 7.560 N WBP1L n/a
7 TRCN0000138380 CCAGAAGATGTCTCGTGTGAA pLKO.1 3554 3UTR 100% 4.950 3.465 N WBP1L n/a
8 TRCN0000138217 CTCATCGATGATGCTCTGGAT pLKO.1 2484 CDS 100% 2.640 1.848 N WBP1L n/a
9 TRCN0000138822 GCGGCAACATGAAATCAACCT pLKO.1 1631 5UTR 100% 2.640 1.848 N WBP1L n/a
10 TRCN0000135803 CGATGACCTCAAAGAGTTCAA pLKO.1 2459 CDS 100% 4.950 2.970 N WBP1L n/a
11 TRCN0000282025 CGATGACCTCAAAGAGTTCAA pLKO_005 2459 CDS 100% 4.950 2.970 N WBP1L n/a
12 TRCN0000135456 GTGTGGGTACCAACAATCAAA pLKO.1 1450 5UTR 100% 0.000 0.000 N WBP1L n/a
13 TRCN0000275319 GTGTGGGTACCAACAATCAAA pLKO_005 1450 5UTR 100% 0.000 0.000 N WBP1L n/a
14 TRCN0000192047 CCACGAGAGAAGCATTAAGTA pLKO.1 2754 3UTR 100% 5.625 7.875 N Wbp1l n/a
15 TRCN0000297606 CCACGAGAGAAGCATTAAGTA pLKO_005 2754 3UTR 100% 5.625 7.875 N Wbp1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.