Transcript: Human XM_017016415.2

PREDICTED: Homo sapiens tudor domain containing 1 (TDRD1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD1 (56165)
Length:
3902
CDS:
164..3163

Additional Resources:

NCBI RefSeq record:
XM_017016415.2
NBCI Gene record:
TDRD1 (56165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164048 CCACCCTAATTTCAGGCTGAA pLKO.1 310 CDS 100% 4.050 5.670 N TDRD1 n/a
2 TRCN0000240913 ACTTCTACGTGCAGTTATATT pLKO_005 996 CDS 100% 15.000 10.500 N TDRD1 n/a
3 TRCN0000158923 CCACTTGTTATCCCAGAATAA pLKO.1 2478 CDS 100% 13.200 9.240 N TDRD1 n/a
4 TRCN0000160552 CCACATAAAGACTTACCAAAT pLKO.1 2546 CDS 100% 10.800 7.560 N TDRD1 n/a
5 TRCN0000162375 CCTCATGTCAGTGTTAGCAAA pLKO.1 1823 CDS 100% 4.950 3.465 N TDRD1 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3854 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3855 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.