Transcript: Human XM_017016539.2

PREDICTED: Homo sapiens inhibitory synaptic factor 2A (INSYN2A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INSYN2A (642938)
Length:
5168
CDS:
1322..2761

Additional Resources:

NCBI RefSeq record:
XM_017016539.2
NBCI Gene record:
INSYN2A (642938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269405 TCGCCTACATTTAACCTATTA pLKO_005 3827 3UTR 100% 13.200 18.480 N INSYN2A n/a
2 TRCN0000281734 CAAACTCCAGCCGGTTCTAAG pLKO_005 2608 CDS 100% 10.800 15.120 N INSYN2A n/a
3 TRCN0000284016 TCCATCCGAAGAGCCCGATTA pLKO_005 1966 CDS 100% 10.800 15.120 N INSYN2A n/a
4 TRCN0000269458 CAGAGCAGCCTACCGCAAATA pLKO_005 1561 CDS 100% 13.200 9.240 N INSYN2A n/a
5 TRCN0000284012 CATCGGGAAGGGCTTTCATAT pLKO_005 2495 CDS 100% 13.200 9.240 N INSYN2A n/a
6 TRCN0000347626 CATCGGGAAGGGCTTTCATAT pLKO_005 2495 CDS 100% 13.200 9.240 N Fam196a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10187 pDONR223 100% 99.9% 100% None 39G>A n/a
2 ccsbBroad304_10187 pLX_304 0% 99.9% 100% V5 39G>A n/a
3 TRCN0000478132 GAACACGAATGGATGCGCCGATAC pLX_317 30.4% 99.9% 100% V5 39G>A n/a
Download CSV