Transcript: Human XM_017016611.2

PREDICTED: Homo sapiens uroporphyrinogen III synthase (UROS), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UROS (7390)
Length:
1233
CDS:
65..943

Additional Resources:

NCBI RefSeq record:
XM_017016611.2
NBCI Gene record:
UROS (7390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016611.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045781 TCAGTGTATGTGGTTGGAAAT pLKO.1 347 CDS 100% 10.800 8.640 N UROS n/a
2 TRCN0000291000 TCAGTGTATGTGGTTGGAAAT pLKO_005 347 CDS 100% 10.800 8.640 N UROS n/a
3 TRCN0000045779 CAGGAGTTATCTGGTGACAAT pLKO.1 689 CDS 100% 4.950 3.960 N UROS n/a
4 TRCN0000291002 CAGGAGTTATCTGGTGACAAT pLKO_005 689 CDS 100% 4.950 3.960 N UROS n/a
5 TRCN0000045780 GATCCGTATATCAGGGAATTA pLKO.1 113 CDS 100% 13.200 9.240 N UROS n/a
6 TRCN0000291001 GATCCGTATATCAGGGAATTA pLKO_005 113 CDS 100% 13.200 9.240 N UROS n/a
7 TRCN0000045778 GCAGAGTTATGTTTGGAGCAA pLKO.1 272 CDS 100% 2.640 1.848 N UROS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016611.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01759 pDONR223 100% 90.7% 90.7% None 660_740del n/a
2 ccsbBroad304_01759 pLX_304 0% 90.7% 90.7% V5 660_740del n/a
Download CSV