Transcript: Human XM_017016623.1

PREDICTED: Homo sapiens zinc finger protein 37A (ZNF37A), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF37A (7587)
Length:
1382
CDS:
826..1077

Additional Resources:

NCBI RefSeq record:
XM_017016623.1
NBCI Gene record:
ZNF37A (7587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07156 pDONR223 100% 14.4% 14% None (many diffs) n/a
2 ccsbBroad304_07156 pLX_304 0% 14.4% 14% V5 (many diffs) n/a
3 TRCN0000475629 CCGCTCCCTGAAGGTCCCTATCCC pLX_317 15.9% 14.4% 14% V5 (many diffs) n/a
Download CSV